Calculate
Paste a primer sequence (5′→3′), or enter base counts. Results update live — nothing is uploaded.
The annealing recommendation is based on the lower of the two primer Tm values.
Nearest-neighbor needs the actual base order, so it is unavailable in counts mode.
Worked examples
Three hand-verified examples. Click “Load into calculator” to reproduce each one above.
Example 1 — 20-mer, balanced composition (the textbook case)
Length 20 nt · A5 T5 G5 C5 · GC 50.0%
Wallace: 60.0°C = 2(10) + 4(10) · GC-content: 51.8°C = 64.9 + 41×(10−16.4)/20 · Nearest-neighbor: 48.8°C (0.25 µM, 50 mM Na⁺)
→ Recommended annealing: 43.8 – 45.8°C, start at 44.8°C
Example 2 — 25-mer, IDT-style composition (A5 T5 G7 C8)
Length 25 nt · GC 60.0%
GC-content: 62.6°C = 64.9 + 41×(15−16.4)/25 · Wallace: 80.0°C (overestimates — primer is too long for Wallace) · Nearest-neighbor: 60.6°C
→ Recommended annealing: 55.6 – 57.6°C, start at 56.6°C
Note: the Wallace value here shows why method choice matters — 80°C would ruin the reaction.
Example 3 — primer pair with a Tm gap (what the warning looks like)
R: ATGCGATCGATCGATCGATCGA (22-mer)
Nearest-neighbor Tm: F 43.5°C · R 51.5°C → gap 8.0°C ⚠
→ Annealing from the lower Tm: 38.5 – 40.5°C, start at 39.5°C
The calculator flags the >5°C gap: ideally redesign so both primers melt within 5°C of each other.
Tm methods compared
No single formula is “correct” — each makes different trade-offs. This calculator shows all four so you can judge.
| Method | Formula | Best for | Limitation |
|---|---|---|---|
| Wallace | Tm = 2(A+T) + 4(G+C) | Primers < 14 nt | Ignores order, length, salt; overestimates long primers badly |
| GC-content | Tm = 64.9 + 41·(G+C−16.4)/N | Primers ≥ 14 nt, quick estimate | Assumes fixed standard conditions (50 nM primer, 50 mM Na⁺, pH 7.0); ignores base order |
| Salt-adjusted | Tm = 81.5 + 16.6·log₁₀[Na⁺] + 0.41·(%GC) − 600/N | When buffer salt differs from standard | Still composition-only; crude length term |
| Nearest-neighbor | Tm = ΔH·1000/(ΔS + R·ln(C/4)) − 273.15 + 16.6·log₁₀[Na⁺] | Best default for 14–30 nt primers | Two-state assumption; ±2–3°C vs experiment; needs full sequence |
How the annealing recommendation is derived
The calculator takes the nearest-neighbor Tm (or the method you select), and for primer pairs the lower of the two Tm values:
This is the widely taught rule of thumb (used in NEB, IDT, and Thermo Fisher guides). Always confirm with a gradient PCR.
Methodology & sources
Formulas implemented (exactly as coded)
where R = 1.987 cal·mol⁻¹·K⁻¹, C = primer concentration in mol/L, [Na⁺] in mol/L. ΔH/ΔS are summed over all nearest-neighbor doublets plus an initiation term (+0.2 kcal/mol, −5.7 cal/mol/K) and a terminal A-T penalty (+2.2, +6.9) per A-T-closed end.
Sources
Wallace rule: Wallace et al., Nucleic Acids Research 6:3543–3557 (1979).
GC-content formula: standard primer-design references; assumes 50 nM primer, 50 mM Na⁺, pH 7.0.
Nearest-neighbor parameters (unified set): SantaLucia, PNAS 95:1460–1465 (1998); SantaLucia & Hicks, Annu. Rev. Biophys. Biomol. Struct. 33:415–440 (2004), Table 1.
Annealing rule Ta = Tm − (3–5)°C: standard PCR primer-design guidelines (NEB, IDT, Thermo Fisher manuals).
The parameter table below is transcribed from the SantaLucia & Hicks unified set; a checksum test (ΣΔH = −83.6, ΣΔS = −223.7) guards the transcription in both the reference implementation and this page's engine.
Honest limitations
· Every Tm here is an estimate — nearest-neighbor typically lands within ±2–3°C of the measured value, the simpler formulas worse.
· The two-state melting model breaks down for very short oligos and for sequences with strong secondary structure.
· Real PCR buffers contain Mg²⁺, dNTPs, and additives (DMSO, betaine) that shift Tm; this calculator models monovalent salt only.
· Primer-dimers, hairpins, and off-target binding are not modeled — check those with a dedicated oligo analyzer before ordering.
· Validate the calculated annealing temperature empirically with a gradient PCR.
Nearest-neighbor parameter table (ΔH kcal/mol · ΔS cal/mol·K, 1 M NaCl)
| Doublet (5′→3′ / 3′→5′) | ΔH° | ΔS° |
|---|---|---|
| AA/TT | −7.9 | −22.2 |
| AT/TA | −7.2 | −20.4 |
| TA/AT | −7.2 | −21.3 |
| CA/GT | −8.5 | −22.7 |
| GT/CA | −8.4 | −22.4 |
| CT/GA | −7.8 | −21.0 |
| GA/CT | −8.2 | −22.2 |
| CG/GC | −10.6 | −27.2 |
| GC/CG | −9.8 | −24.4 |
| GG/CC | −8.0 | −19.9 |
| initiation | +0.2 | −5.7 |
| terminal A-T (per end) | +2.2 | +6.9 |
Frequently asked questions
Straight answers to the questions people actually search about PCR annealing temperature.
What is annealing temperature in PCR?
The annealing temperature (Ta) is the temperature of the PCR cycle step at which short DNA primers bind (anneal) to their complementary target sequences on the template DNA. A typical PCR cycle moves through denaturation (~94-95°C), annealing (~50-65°C), and extension (~72°C). Setting the right annealing temperature is critical: it determines whether your primers bind specifically to the intended target or fail to bind at all.
How do you calculate annealing temperature from primer Tm?
The standard rule of thumb is: annealing temperature = (lowest primer melting temperature) minus 3 to 5°C. For example, if your primers have Tm values of 62°C and 58°C, start with an annealing temperature between 53°C and 55°C (a 54°C starting point is typical). This calculator applies exactly that rule to the nearest-neighbor Tm by default. Because every formula is an estimate, confirm the optimum empirically with a gradient PCR spanning roughly ±5°C around the calculated value.
What is the difference between melting temperature (Tm) and annealing temperature?
Melting temperature (Tm) is a property of the primer itself: the temperature at which 50% of the primer-template duplex has dissociated into single strands. Annealing temperature (Ta) is a setting you program into the thermal cycler, chosen a few degrees below the lowest primer Tm so primers bind efficiently yet specifically. In short: Tm is measured/calculated from the sequence; Ta is derived from Tm (Ta ≈ Tm − 3-5°C).
What is the Wallace rule for primer melting temperature?
The Wallace rule estimates Tm as 2°C for every A-T pair plus 4°C for every G-C pair: Tm = 2(A+T) + 4(G+C). For a 20-mer with 10 A/T and 10 G/C bases, Tm = 2(10) + 4(10) = 60°C. It is only reliable for short primers (fewer than 14 nucleotides); for standard 18-30 nt PCR primers the GC-content formula or the nearest-neighbor method is preferred. Source: Wallace et al., Nucleic Acids Research 6:3543-3557 (1979).
Which Tm calculation method is most accurate for PCR primers?
The nearest-neighbor (thermodynamic) method is the most sequence-specific because it accounts for base-stacking interactions between adjacent bases, not just overall composition. The GC-content formula (Tm = 64.9 + 41×(G+C−16.4)/N) is a good quick estimate for primers of 14+ nt. The Wallace rule is only for very short primers (<14 nt). The salt-adjusted formula adds an explicit sodium-ion correction. Even the best method is typically accurate to about ±2-3°C versus experiment, so treat every calculated Tm as a starting point, not a guarantee.
What happens if the PCR annealing temperature is too high?
If Ta is set too close to (or above) the primer Tm, primers cannot stably bind the template during the annealing step. The visible result is weak or no amplification: faint bands or a completely blank gel/late Ct values in qPCR. The fix is to lower the annealing temperature toward Tm − 5°C, or redesign primers with a higher Tm.
What happens if the PCR annealing temperature is too low?
Too-low annealing temperature lets primers bind non-specifically: to partially matching sites, to each other (primer-dimers), or to off-target regions. Symptoms include extra bands, smears on the gel, primer-dimer artifacts, and reduced yield of the correct product. Raise Ta in 1-2°C steps (a gradient PCR finds the sweet spot), or redesign primers with better specificity.
Should forward and reverse primers have the same melting temperature?
Ideally yes: the two primers in a pair should have Tm values within 5°C of each other (closer is better). A large gap forces a compromise annealing temperature that is suboptimal for one primer, causing uneven or failed amplification. This calculator flags pairs whose nearest-neighbor Tm values differ by more than 5°C so you can redesign before ordering.
What is the ideal GC content for PCR primers?
Aim for 40-60% GC content. Below 40%, primers bind weakly and need lower annealing temperatures; above 60%, they are prone to secondary structures (hairpins) and mispriming, and may need additives like DMSO. Also prefer a G or C at the 3' end (a 'GC clamp') to anchor priming, and avoid runs of 4+ identical bases, especially G/C runs at the 3' end.
Why does salt concentration change primer melting temperature?
The DNA backbone carries negative charges (phosphates) that repel the two strands. Positive ions (mainly Na+ and Mg2+) shield this repulsion and stabilize the duplex, so higher salt raises Tm. That is why the salt-adjusted and nearest-neighbor formulas include an explicit term, 16.6×log10[Na+]. A typical PCR buffer contributes roughly 50 mM monovalent cations, which is this calculator's default.
What primer concentration should I enter in the calculator?
Use the final primer concentration in your PCR mix, typically 0.1-0.5 µM (100-500 nM) per primer; 0.25 µM is a common default and is what this calculator assumes. Concentration only affects the nearest-neighbor calculation (higher concentration slightly raises Tm); the Wallace, GC-content, and salt-adjusted formulas ignore it.
Why does this calculator give a different Tm than NEB, IDT, or Thermo Fisher tools?
Different vendors use different formulas, thermodynamic parameter sets, salt corrections, and concentration conventions, and some (like NEB's tool) are tuned for their own polymerases and buffers. For example, a GC-content formula assumes fixed standard conditions while a nearest-neighbor tool adjusts for your salt and primer concentration. Differences of a few degrees between tools are normal and expected — which is why you should validate the calculated annealing temperature with a gradient PCR rather than trusting any single number.
Can I use this annealing temperature calculator for qPCR?
Yes. The primer Tm and the Ta = Tm − 3-5°C rule apply the same way in qPCR (including SYBR Green assays), because primer annealing physics does not change. For probe-based qPCR (e.g., TaqMan), the probe Tm is usually designed ~10°C above the primer Tm, which this calculator does not cover — use your probe vendor's guidelines for that part.
Is the annealing temperature the same in every PCR cycle?
In a standard protocol, yes: one fixed annealing temperature is used for all cycles. The exception is touchdown PCR, where the annealing temperature starts several degrees above the calculated Ta and is decreased by ~0.5-1°C per cycle for the first 10-15 cycles to favor the most specific binding early on. This calculator gives you the baseline Ta that a touchdown protocol would converge toward.