BIOINFORMATICS · 100% CLIENT-SIDE
DNA to mRNA Converter
Transcribe a DNA sequence to mRNA, then translate codons to amino acids — with start/stop highlighting, all 3 reading frames, GC content, reverse complement, and honest sequence validation. Nothing leaves your browser.
1 · Paste your DNA sequence
2 · Results
Worked examples (computed live by the same engine)
Template strand 3′-TACAAA-5′ → mRNA 5′-AUGUUU-3′ → Met-Phe (AUG = start codon).
Insulin B-chain fragment, coding TTTGTGAACCAACACCTGTGC (21 nt, GC 47.619%) → mRNA UUUGUGAACCAACACCUGUGC → Phe-Val-Asn-Gln-His-Leu-Cys.
GFP start, coding ATGGTGAGCAAGGGCGAG → mRNA AUGGUGAGCAAGGGCGAG → Met-Val-Ser-Lys-Gly-Glu.
Reading frames change everything: mRNA AAUGUUU reads AAU-Asn GUU-Val in frame 1 but AUG-Met UUU-Phe in frame 2.
Interactive codon table (standard genetic code)
| Codon | Amino acid | 1-letter | Type |
|---|
How it works
Template mode: mRNA is the antiparallel complement of the template strand, with U replacing T (T→A, A→U, C→G, G→C). Coding mode: mRNA copies the coding strand with T→U. Translation groups the mRNA 5′→3′ into codons using the standard genetic code: AUG (Methionine) is the start codon; UAA, UAG, UGA are stop codons. GC content = (G+C) ÷ length × 100. Only A, C, G, T are accepted — anything else is reported, never guessed.
Scope boundary: this tool performs direct transcription of the sequence you paste. It does not model splicing, introns/exons, splice variants, promoters, 5′ caps, or poly-A tails. Related tool: Protein Molecular Weight Calculator — compute a protein's mass from its amino-acid sequence after translating here.
Frequently asked questions
What is the start codon in mRNA?
The start codon is AUG, which codes for methionine (Met). Translation normally begins at the first AUG in the correct reading frame. Try the built-in example: template strand 3'-TACAAA-5' transcribes to mRNA 5'-AUGUUU-3', whose first codon AUG is highlighted as the start codon, followed by UUU (Phe).
What are the stop codons?
The three stop codons are UAA, UAG, and UGA. They do not code for any amino acid; instead they signal the ribosome to end translation. Example: the DNA coding sequence TAATAGTGA transcribes to mRNA UAAUAGUGA, which translates to Stop-Stop-Stop.
Why does mRNA use U (uracil) instead of T (thymine)?
RNA uses uracil where DNA uses thymine. Chemically, thymine is 5-methyluracil: DNA pays a small extra energy cost for the methyl group because it makes spontaneous deamination damage (C turning into U) easy for repair enzymes to spot — a U in DNA is a red flag, while a U in RNA is normal. In transcription the pairing rule is simply DNA A pairs with RNA U, DNA T pairs with RNA A, DNA C pairs with RNA G, DNA G pairs with RNA C.
What is the difference between the template strand and the coding strand?
The template strand (read 3' to 5') is the one RNA polymerase actually copies, so the mRNA is its complement with U in place of T. The coding strand (5' to 3') is not copied; its sequence matches the mRNA, except every T becomes U. This converter supports both: pick template mode for the strand the polymerase reads, or coding mode for the strand that looks like the mRNA. Both modes agree: template 3'-TACAAA-5' and coding 5'-ATGTTT-3' both produce mRNA 5'-AUGUUU-3'.
What is a reading frame, and why does this tool show three of them?
Ribosomes read mRNA in consecutive triplets (codons), so the same sequence can be grouped three different ways depending on where you start counting. These are the three reading frames. They can give completely different proteins: mRNA AAUGUUU in frame 1 reads AAU-Asn GUU-Val, but in frame 2 it reads AUG-Met UUU-Phe — starting with the AUG start codon. In cells the frame is set by where the ribosome starts; this tool lets you inspect all three.
What is wobble base pairing?
Wobble is the observation (Crick, 1966) that the third position of a codon pairs less strictly: a single tRNA anticodon can recognize more than one codon, often through a G-U pair at the wobble position. That is why the genetic code is redundant — for example, CUU, CUC, CUA, and CUG all code for leucine. This tool uses the standard codon table, which already folds wobble redundancy into the amino-acid assignments.
Does this tool predict splicing or splice variants?
No. This tool performs direct transcription of exactly the sequence you paste: every input base becomes one mRNA base. In eukaryotic cells, the initial transcript (pre-mRNA) is spliced — introns are removed and exons joined, sometimes in alternative combinations (splice variants). This converter does not model splice sites, introns, exons, 5' caps, poly-A tails, or any post-transcriptional processing.
In which direction is mRNA read?
mRNA is synthesized and read 5' to 3'. RNA polymerase builds the new strand in the 5'-to-3' direction while moving along the template strand 3' to 5', and the ribosome likewise reads codons 5' to 3'. This tool always displays the mRNA 5'-to-3', left to right.
Can I paste a FASTA sequence?
Yes. Lines starting with > (FASTA headers) are ignored, and all whitespace and line breaks are stripped before transcription. The sequence itself must still contain only A, C, G, and T (upper or lower case).
Which characters are accepted, and what happens with invalid ones?
Only the four DNA bases A, C, G, and T are accepted, case-insensitive. Anything else — N, U, numbers, punctuation — is rejected honestly: the tool lists the exact offending characters instead of silently guessing or dropping them. An empty input is also rejected with a clear message.
Free tool by NRTechStudio