Turn an A260 absorbance reading into concentration (ng/µL), purity ratios and total yield — for dsDNA, ssDNA, RNA and oligos. With dilution factor, pathlength correction and show-your-work steps.
Enter the absorbance of your diluted sample exactly as the instrument reported it. Everything updates live.
Formula: C = (A260 ÷ pathlength in cm) × CF × DF. 1 ng/µL is exactly 1 µg/mL. Standard factors: dsDNA 50 · ssDNA 33 · RNA 40 (µg/mL per A260 at 1 cm). Sources in Methodology below.
Every number above, derived step by step.
This tool computes nucleic-acid concentration from a spectrophotometer absorbance reading (A260). If you instead need to dilute a stock to a target concentration (C1V1 = C2V2, serial dilutions), use our cell dilution calculator — different intent, different math.
Related but different: absorbance measures all nucleic acids in the tube — it cannot tell dsDNA from RNA or free nucleotides. For dye-specific quantification (dsDNA only), a fluorometer (Qubit) is the right instrument; see the FAQ.
Hand-checked numbers — try them in the calculator above.
A260 = 0.85 (1 cm cuvette) · dilution factor 10 · eluted in 50 µL.
C = 0.85 × 50 × 10 = 425 ng/µL (= 425 µg/mL).
Yield = 425 × 50 ÷ 1000 = 21.25 µg total plasmid.
A260 = 0.60, A280 = 0.29, A230 = 0.27 · dilution factor 20 · 30 µL total.
C = 0.60 × 40 × 20 = 480 ng/µL → yield 14.4 µg.
A260/A280 = 2.07 (pure RNA ≈ 2.0 ✓), A260/A230 = 2.22 (clean ✓).
Sequence ATGCGTACGTAGCTAGCTAG · raw A260 = 1.50 at 1 mm path, undiluted.
Normalized: 1.50 × (10/1) = 15.0 A260 (1 cm).
Sequence-based: ε = 218,300 L/mol/cm, MW = 6,281.0 Da →
C = 15.0 × 6,281.0 × 1000 ÷ 218,300 = 431.6 µg/mL (= 68.7 pmol/µL).
Rule-of-thumb check: 15.0 × 25 = 375 µg/mL — the generic factor underestimates this oligo by ~13%, which is why the sequence mode exists.
Where every constant comes from. No black boxes.
Absorbance A = ε · c · l. For routine nucleic-acid work the extinction coefficient is folded into an empirical conversion factor CF, giving the bench formula:
C = (A260 ÷ l) × CF × DF
where C is concentration (ng/µL = µg/mL), A260 the absorbance of the diluted sample, l the pathlength in cm, CF the conversion factor and DF the dilution factor.
| Nucleic acid | 1 A260 (1 cm) = | Source |
|---|---|---|
| dsDNA | 50 µg/mL | Maniatis / Sambrook Molecular Cloning; Thermo NanoDrop user guide |
| ssDNA | 33 µg/mL | NEB / VectorBuilder OD260 reference |
| RNA | 40 µg/mL | Farrell RNA Methodologies; Thermo NanoDrop user guide |
| Oligo (≈20-mer) | ≈25 µg/mL | PerkinElmer app note (23-mer); rule of thumb — use sequence mode for precision |
A standard cuvette has a 10 mm (1 cm) path. A NanoDrop measures at 1 mm or 0.2 mm and its software already multiplies the displayed A260 back to a 10 mm equivalent — if your reading says “A260 (10 mm)”, select 10 mm here, not 1 mm, or you will overestimate 10-fold. Only select 1 mm / 0.2 mm for a raw short-path reading.
| Ratio | Pure | Low means… | High means… |
|---|---|---|---|
| A260/A280 (DNA) | ≈ 1.8 | protein contamination | RNA contamination |
| A260/A280 (RNA) | ≈ 2.0 | protein contamination | — |
| A260/A230 | 2.0 – 2.2 | organics: guanidine, phenol, carbohydrates | usually blanking artifact |
ε is summed from individual bases (L/mol/cm): A 15,400 · C 7,200 · G 11,500 · T 8,700 · U 9,900 — then C(µg/mL) = A × DF × MW × 1000 ÷ ε, with MW from residue masses plus a 61.96 Da terminal correction. This nearest-neighbor-sum approximation is the standard bench method (cf. NEB’s oligo guidelines).
What this math cannot tell you.
Real questions from the search box, answered properly.
The bench formula is C = (A260 / l) x CF x DF: divide the absorbance of the diluted sample by the pathlength in cm, multiply by the conversion factor (50 for dsDNA, 33 for ssDNA, 40 for RNA), then multiply by the dilution factor. Example: A260 = 0.85, 1 cm cuvette, 10x dilution, dsDNA -> 0.85 x 50 x 10 = 425 ng/uL. The calculator above does this instantly and shows every step.
It comes from the Beer-Lambert law (A = e x c x l) with an empirically determined extinction coefficient: on average, a 1 mg/mL solution of dsDNA has an absorbance of 20 at 260 nm in a 1 cm cuvette, so 1 absorbance unit corresponds to 1/20 mg/mL = 50 ug/mL, which is exactly 50 ng/uL. The 33 (ssDNA) and 40 (RNA) factors are the equivalent averages for those molecules, documented in Maniatis/Sambrook Molecular Cloning and the Thermo NanoDrop user guide.
Pure dsDNA gives A260/A280 of about 1.8. A ratio clearly below ~1.75 suggests protein contamination (proteins absorb strongly at 280 nm); a ratio well above ~1.95 suggests RNA contamination (pure RNA reads ~2.0). For RNA samples the pure target is ~2.0 instead. This calculator interprets both ratios automatically when you enter A280.
It flags organic contamination. Pure nucleic acids give A260/A230 between 2.0 and 2.2. Values below ~2.0 point to carryover from the extraction chemistry - guanidine salts, phenol, EDTA or carbohydrates. A low 260/230 with a fine 260/280 is the classic signature of a clean-looking prep that will still inhibit enzymes.
A NanoDrop measures through a 1 mm (or 0.2 mm) liquid column instead of a 1 cm cuvette, then its software multiplies the displayed A260 back to the 10 mm equivalent. So if your NanoDrop shows 'A260 (10 mm)', select the 10 mm pathlength in this calculator - choosing 1 mm would inflate your result 10-fold. Only use the 1 mm / 0.2 mm options for a raw, un-normalized short-path reading.
Multiply the stock concentration by the total volume and convert units: yield (ug) = concentration (ng/uL) x volume (uL) / 1000. Example: 425 ng/uL in 50 uL gives 425 x 50 / 1000 = 21.25 ug. Enter your elution volume in the calculator and the yield is computed for you.
It depends on the application, as total input mass rather than concentration: a PCR typically wants 1-10 ng of template per reaction; Sanger sequencing 5-20 ng; Illumina whole-genome libraries around 1 ug of input DNA; Oxford Nanopore 400 ng to 1 ug. Concentration matters only for pipetting a sensible volume - divide the required mass by your measured ng/uL to get the microliters to add.
They measure different things. A spectrophotometer (NanoDrop) reads absorbance at 260 nm - fast and convenient, but it counts every nucleic acid and many contaminants together, so it overestimates dirty samples. A fluorometer (Qubit) uses a dye that fluoresces only when bound to dsDNA, so it is specific and far more sensitive at low concentrations. Use absorbance for quick purity checks, fluorescence when the number has to be right.
Each base absorbs differently, so the extinction coefficient is summed from the base composition: A 15,400, C 7,200, G 11,500, T 8,700 (L/mol/cm), plus a small terminal correction. Then C(ug/mL) = A260 x dilution x MW x 1000 / e. The generic '1 A260 = 25 ug/mL' oligo rule is just an average - for the 20-mer in the worked example above it underestimates by ~13%, which is why this calculator offers a sequence-based mode.
Almost always a blanking problem: the instrument was blanked with a different buffer than the sample is in, or the blank itself drifted. Re-blank with the exact elution buffer, wipe the pedestal (NanoDrop), and re-read. This calculator refuses to compute a concentration from a zero or negative A260 instead of silently producing a nonsense number.
Beer-Lambert only holds while the detector responds linearly - roughly A260 0.1 to 1.0 for the diluted sample on most instruments. Above ~2.0 the reading saturates and the computed concentration becomes unreliable. This calculator flags readings above 2.0; the correct move is to dilute the sample further and re-read, not to trust the number.
OmniCalculator's page covers the basic (A260/l) x CF x DF formula in a single thin calculator. This one goes further: pathlength correction for NanoDrop raw readings, ssDNA/RNA/oligo/custom-factor modes, a sequence-based oligo calculator with extinction coefficient and pmol/uL, A260/A280 and A260/A230 purity interpretation, total yield, show-your-work steps, three hand-checked worked examples, and an honest limitations section - all computed 100% in your browser.
Different intent, different math. This tool derives nucleic-acid concentration from a spectrophotometer absorbance reading. A cell dilution calculator (like ours) starts from a known cell density and computes pipetting volumes via C1V1 = C2V2. If you need to dilute a stock to a target concentration, use the cell dilution tool; if you need to turn an A260 into ng/uL, you are in the right place.
Free tool by NRTechStudio
Explore similar developer tools and calculators. 100% free, accurate, and runs completely in your browser without sign-up.
2 taps, no typing needed — diagnostics are sent automatically.